Le ZNRD Zinc Ribbon Domain-Containing est un facteur cellulaire hôte qui influence la réplication du VIH et la progression de la maladie

Le gène ZNRD zinc ribbon domain-containing a été identifié comme codant un facteur potentiel d’hôte qui a influencé la progression de la maladie chez des individus séropositifs dans une étude d’association génomique et également significativement affectée. La réplication du VIH dans un criblage d’ARN interférent court in vitro à grande échelle Les gènes et les polymorphismes identifiés par une analyse à grande échelle doivent être suivis au moyen de tests fonctionnels et de reséquençage pour cartographier plus précisément les gènes causauxMethodsGenotyping et le reséquençage des gènes ZNRD Les sujets ayant présenté une progression de la maladie normale ont été soumis à des tests de génotypage TaqMan ou à un séquençage direct. Une analyse d’association génétique a été réalisée avec le package SNPassoc et le siRNA du logiciel Haploview et un shRNA en épingle à cheveux courte ciblant spécifiquement le ZNRD. tran réguler de manière stable ou stable vers le bas l’expression de ZNRD dans les cellules lymphoïdes et non lymphoïdes. Les cellules ont été infectées par des souches X et R du VIH, et l’efficacité de l’infection a été évaluée par un test de gène rapporteur. -nucléotide polymorphisme rs; P =, indépendamment de l’influence HLA-A analyse fonctionnelle siRNA a montré que la régulation négative ZNRD par siRNA ou shRNA altéré la réplication du VIH au niveau de la transcription dans les cellules lymphoïdes et non lymphoïdesConclusionGenetic analyse d’association identifié ZNRD comme un marqueur indépendant de LTNP à SIDA De plus, des expériences in vitro ont indiqué que la transcription virale était l’étape inhibée. Ainsi, nos données suggèrent fortement que ZNRD est un facteur cellulaire hôte qui influence la réplication du VIH et la progression de la maladie chez les personnes séropositives.

Les humains montrent une variation remarquable de leur vulnérabilité à l’infection par le virus de l’immunodéficience humaine VIH, en particulier par rapport aux résultats cliniques après infection L’hétérogénéité considérable de l’épidémie est au moins partiellement déterminée par les variations des gènes qui influencent la réplication virale. coder le génome du VIH pour les seules protéines, nécessitant de nombreux facteurs cellulaires pour compléter le cycle de réplication du virus Ainsi, un grand nombre de facteurs de l’hôte contribuent probablement à la variabilité des phénotypes liés au VIH, y compris les variants génétiques Des avancées récentes en génomique et en interférence ARN ont conduit à la réalisation d’enquêtes génomiques pour identifier les gènes cellulaires affectant la maladie humaine et la réplication du VIH La première analyse d’association génomique pour les déterminants du contrôle VIH-hôte chez l’homme identifié un certain nombre de régions génomiques associées au point de consigne de charge du VIH et / ou Parmi eux, un locus sur le chromosome humain, proche des gènes ZNRD contenant le zinc ribonucléotidique et RNF ring finger mais aussi des locus HLA, fortement corrélé avec la progression de la maladie VIH Un écran fonctionnel génomique a également identifié ZNRD parmi & gt; facteurs de l’hôte nécessaires à la réplication du VIH La connaissance des facteurs cellulaires et de leur interaction dans le cycle de vie du VIH est essentielle pour mieux comprendre la réplication virale et la pathogenèse de la maladie, ainsi que pour trouver de nouvelles cibles thérapeutiques potentielles. gène, CCR CC chimiokine récepteur, a été exploité avec succès comme cible pour l’intervention anti-VIH Malgré leur énorme pouvoir et intérêt, les criblages génomiques à grande échelle ne devraient être pris que comme points de départ. dans un système cellulaire physiologiquement pertinent, et les associations génétiques devraient être validées dans des populations indépendantesZNRD code pour une protéine constituée de domaines de ruban de zinc Le domaine C-terminal est bien conservé dans de nombreux organismes comme motif associé à la transcription. codant pour une sous-unité de l’ARN polymérase I En tapant des polymorphismes précédemment décrits et nouveaux dans la génomique ZNRD région avec HLAA, nous identifions sans équivoque ZNRD comme un marqueur indépendant de non-progression LTNP à long terme Des expériences in vitro ont montré que knockdown de l’expression ZNRD inhibé la réplication du VIH à la transcription dans les deux cellules lymphoïdes et non lymphoïdes

Méthodes

Patients et échantillons

Au total, les patients infectés par le VIH qui ont souffert de LTNP et qui ont connu une progression normale de la maladie ont été inclus dans l’étude. Les progresseurs de l’unité VIH de l’Hôpital Universitaire Germains Trias i Pujol ont été sélectionnés sur la base d’un compte de cellules CD de & lt; cellules / μL avec des années ou moins d’infection signalée Des échantillons de patients du PNLT ont été fournis par la BioBank VIH, en utilisant des critères d’éligibilité modifiés par rapport à ceux rapportés ailleurs Critères d’éligibilité confirmés infection VIH pendant des années, nombre de cellules CD de & gt; cellules / mL tout au long de l’infection, et des charges virales de & lt; copies / mL sans traitement antirétroviral

Tableau Données phénotypiques sur les patients inclus dans l’étude Sexe du patient, sans phénotype IQR médian Charge virale plasmatique virale mâle à point de consigne, nombre de copies / mL de cellules CD au point de consigne, cellules / μL PNLP n = – – Progression n =, – , – Sexe du patient, pas de phénotype IQR médian Charge virale du plasma femelle mâle au point de consigne, un nombre de copies / mL de cellules CD au point de consigne, cellules / μL PNLP n = – – Progression n =, -, – NOTE Ce tableau apparaît seulement dans la version en ligne de la revue IQR, gamme interquartile; LNTP, nonprogression à long termeaLe point de consigne a été considéré comme la première détermination disponible pour chaque patient. Les échantillons LargeBlood ont été traités conformément aux procédures actuelles Tous les patients ayant participé à l’étude ont donné leur consentement éclairé et les protocoles ont été approuvés par le comité scientifique.

Génotypage d’échantillons d’ADN

La séquence codante entière du gène ZNRD a été amplifiée par PCR en chaîne par polymérase et séquencée en utilisant un analyseur génétique ABI Prism. Les amorces Applied Biosystems étaient les suivantes: pour le fragment, ‘-CGAGACACGGTTCGCAATTA’ ‘et’ -CAACCCAACCGATCTTGAGT-areverse; pour le fragment, ‘-GGCGGTTGTACATTTGGTCT-‘ forward et ‘-AATAAGGGATGGGACCAAGG-areverse; et pour le fragment, ‘-GTTTAGGGGAGCCAGTCCTCC-‘ forward et ‘-GCCTCATTCCTGACTCTACTTTT-areverse Le SNP du polymorphisme mononucléotidique RS a été typé en utilisant le test de génotypage SNP TaqMan C; Le typage des échantillons d’ADN par HLA-A d’Applied Biosystems a été réalisé à l’aide du kit SSP en vrac à faible résolution HLA-B Olerup

Cellules

Des cellules HeLa-PR-MAGI, TZM-bl, SupT et MOLTCCR, programme de recherche et de référence sur le SIDA, des National Institutes of Health des Etats-Unis, ont été cultivées dans du milieu DMEM Eagle modifié par Dulbecco; Gibco ou Roswell Park Memorial Institute Milieu de culture de l-glutamine RPMI Les milieux de culture de Gibco ont été complétés avec% de sérum de veau fœtal inactivé par la chaleur et des antibiotiques

Drogues

La zidovudine a été achetée auprès de Sigma-Aldrich L’inhibiteur de l’intégrase du VIH L- a été obtenu auprès de Merck L’inhibiteur de fusion T- a été synthétisé par le Service de synthèse peptidique, Université de Barcelone, Espagne

ARN interférents courts

ARN interférants courts siRNA ciblant le transcrit ZNRD ZNRD_, UCGCUGUGGCUUCAACAUCA; ZNRD_, CUCGAUGUGGUCAUGAAGGAA et transcription RNF RNF_, ACGCCCATTGCAGGAGTATTA; RNF_, CCGCCGCAGCCTGAGGTCTAA ont été achetés auprès de Qiagen Nontargeting siRNA témoin siNT était un pool disponible dans le commerce auprès de Dharmacon; siRev / Env siRNA ciblant une séquence virale a été décrite ailleurs

Génération de lignées cellulaires exprimant de manière stable des ARN courts en épingle à cheveux

Vecteurs d’expression lentiviraux auto-inactivants commerciaux pLKO-puro; En bref, les lentivirus exprimant shRNA ont été générés par cotransfection dans les cellules T, le vecteur pLKO, un plasmide auxiliaire psPAX, et un plasmide exprimant la protéine G du virus de la stomatite vésiculaire. ont été infectés et les cellules exprimant shRNA ont été sélectionnées comme décrit ailleurs

Western blot

Les cellules ont été récoltées, lavées et lysées dans du tampon de lyse de cellules tampons hypotoniques refroidies; Invitrogen Après l’exécution des échantillons, les membranes ont été bloquées, incubées avec des anticorps primaires ZNRD,:, Abnova; Actin,:, Santa Cruz Biotechnology pendant une nuit à ° C, puis incubé avec un anticorps conjugué à la peroxydase de raifort Des membranes ont été révélées avec le substrat chimioluminescent SuperSignal West Pico Pierce Biotechnology Pour RNF, différents anticorps commerciaux ont été testés, mais aucun d’entre eux détecter les données protéiques RNF non montrées

PCR quantitative en temps réel

Les ARNm messagers ont été mesurés par PCR quantitative en temps réel qPCR et normalisés à l’expression de l’ARNm de GUSB. Pour les gènes humains, les amorces et les sondes d’ADN ont été achetées sur le marché. Hs_m pour ZNRD, Hs_m pour RNF, et Hs_m pour GUSB; L’ADN viral de Applied Biosystems a été extrait en utilisant un kit d’extraction d’ADN QIAAmp QIAmp DNA Blood Mini kit; Qiagen L’amplification quantitative de la longue répétition terminale [LTR] pour la détection de l’entrée virale a été réalisée comme décrit ailleurs dans les amorces, ‘CAAGCAGCCATGCAAATGTT -‘ [forward] et ‘-TGCACTGGATGCAATCTATCC -‘ [reverse]; L’intégration virale a été détectée par préamplification Alu-LTR suivie de LTR qPCR Pour l’analyse de la transcription du VIH, l’ADN complémentaire a été utilisé pour qPCR de l’ARN viral total, de l’ARN non épissé et de l’ARN précédemment ailleurs

Infection par le VIH et réplication

La souche R du VIH-BaL a été cultivée dans des cellules mononucléées du sang périphérique stimulées avec de la phytohémagglutinine et de l’interleukine HeLa-PR-MAGI ou TZM-. les cellules bl ont été ensemencées dans des boîtes bien et infectées; h après l’infection, les cellules ont été lysées et maintenues congelées jusqu’à ce que le test β-galactosidase soit effectué. Les cellules SupT ont été infectées pour h, lavées et remises en suspension dans du milieu RPMI. La production de VIH a été analysée, ou jours après infection par test immunosorbant Innotest VIH p antigène; Innogénétique dans les surnageants de culture

Test de détection de la β-galactosidase

L’activité de β-galactosidase dans μL d’extrait cellulaire a été quantifiée par un test colorimétrique, comme décrit ailleurs L’absorbance a été mesurée à – nm

siRNA et transfection plasmidique

Des cellules TZM-bl ont été ensemencées dans des plaques bien. Un jour plus tard, des siRNA ou des plasmides ont été mélangés avec du réactif Lipofectamine Invitrogen dans du milieu sans sérum Invitrogen puis ajoutés aux cellules précédemment lavées Après h, du DMEM frais a été ajouté transfectées dans des cellules SupT au moyen de la technologie Amaxa Nucleofection Lonza, conformément aux recommandations du fabricant Ensuite, les cellules ont été récupérées et ensemencées dans des plaques préchauffées à chaud. La viabilité cellulaire et l’expression ont été contrôlées plusieurs jours après la transfection. kit Qiagen, conformément aux instructions du fabricant Après la transcription inverse avec des hexamères Expand RT; Roche, ZNRD a été amplifiée en utilisant les amorces suivantes, qui ont respectivement introduit EcoRI et Clal montré en caractères gras: ‘-GAATTCgccaccATGTCTGTCATGGACCT-CGCCAATAC-‘ et ‘-ATCGATggctcaAGAGTCTTCCTTC-TCCTGGAACTTG-‘ Les produits de PCR ont été digérés avec EcoRI et Clal, introduits dans le vecteur d’expression pLPCX Clontech, et vérifié par séquençage

analyses statistiques

Le test apparié Student t a été utilisé pour la comparaison entre les associations pour chaque SNP et les odds ratios ont été calculés en utilisant la régression logistique, comme implémenté dans le logiciel de la bibliothèque SNPassoc R. La classe de référence était l’homozygotie pour l’allèle majeur modèles: codominant, dominant, récessif et additif Le meilleur modèle a été choisi en utilisant les critères d’information d’Akaike. La correction de Bonferroni pour les SNP non monomorphes a été utilisée pour corriger les comparaisons multiples. Un facteur de correction supplémentaire a été appliqué pour tenir compte des différences génétiques. En utilisant ce critère, le niveau de signification statistique corrigé a été fixé à Haplotype, les blocs ont été estimés en utilisant l’algorithme -gamete-rule, tel qu’implémenté dans le logiciel Haploview Les comparaisons d’haplotypes entre groupes ont été effectuées en utilisant le test Correction analyse par permutation, permutations aléatoires

Résultats

Association entre les polymorphismes du gène ZNRD et le phénotype LTNP

Pour disséquer et cartographier le gène causal influençant la progression de la maladie VIH sur le locus chromosomique humain, la région codante entière de ZNRD a été reséquencée chez les patients progressistes séropositifs pour le VIH et chez les patients LTNP. polymorphismes – le SNP rs, près de rs , et HLA-A – ont été typés

Figure Vue largeDownload slidePolymorphismes analysés et le schéma LD de déséquilibre de liaison du gène ZNRD A, Localisation génomique des gènes des boîtes vertes et des polymorphismes mononucléotides SNPs flèches présentes sur le chromosome p Dans le panneau supérieur, la localisation relative des SNP précédemment associée à l’immunodéficience humaine différentielle Ci-dessous, la région du gène ZNRD criblée avec les positions relatives des SNP analysés est représentée par les SNP avec des associations positives après correction de Bonferroni en caractères gras de type B, les blocs LD du déséquilibre de liaison dans le gène ZNRD, estimés par des moyens du logiciel Haploview suivant l’algorithme -gamete-rule Les haplotypes associés à la non-progression à long terme sont indiqués dans les cases, avec les valeurs P corrigées correspondantes Les valeurs P nominales sont indiquées entre parenthèses La correction pour les tests multiples a été effectuée par analyse par permutation. le tracé de LD correspond à D ‘/ LOD et D Les valeurs LD, respectivement D ‘est la valeur de D [Hedridgeos multiallélique D] entre les locus; LOD est le log du quotient de probabilité, une mesure de la confiance dans la valeur de l’ADN analysé et le déséquilibre LD du gène ZNRD, la localisation génomique des gènes des boîtes vertes et des polymorphismes mononucléotidiques SNPs flèches Présente sur le chromosome p Dans le panneau supérieur, la position relative des SNP précédemment associés aux résultats cliniques de type virus de l’immunodéficience humaine différentielle est représentée [,,] Ci-dessous, la région du gène ZNRD avec les positions relatives des SNP analysés. La correction de Bonferroni est représentée en gras B, Liaison déséquilibre LD blocs dans le gène ZNRD, estimée au moyen du logiciel Haploview suivant l’algorithme -gamete-rule Les haplotypes associés à la non-progression à long terme sont indiqués dans les cases, avec les valeurs P corrigées correspondantes Les valeurs P nominales sont indiquées entre parenthèses. La correction pour les tests multiples a été effectuée par analyse de permutation Les couleurs et les valeurs dans le tracé de LD correspondent aux valeurs D ‘/ LOD et D’LD, respectivement D’ est la valeur de D [Hedridgeos multiallélique D] entre les loci; LOD est le log du ratio de probabilité de probabilité, une mesure de confiance dans la valeur de D ‘

Diagramme de LD de la région chromosomique associée au virus de l’immunodéficience humaine Progression de la maladie VIHFigure Voir en grandDisque de téléchargement Diagramme de déséquilibre LD de la région chromosomique associée au virus de l’immunodéficience humaine Progression de la maladie VIHPlus de SNP ont été trouvés dans le gène Analyse de l’association génétique, avec rs Figure A Tous les SNP étaient en équilibre de Hardy-Weinberg et avaient une fréquence de génotypage réussie de% Table

Position de la table, équilibre de Hardy-Weinberg HW, et fréquence génotypique des polymorphismes mononucléotidiques analysés Hétérozygotie Nom Position Observer Prévu HW P Génotype,% Indice d’allèle MAF rs_CT & gt; C: T rs_GC & gt; C: G rs_insinsG_NIno_insertion_insinsG A: G rs_CG & gt; C: G rs_GT & gt; G: T rs_CG C: G rs_GA G: A rs_GA & gt; G: A rs_GA G: A rs_TA T: A Exclus de l’analyse rs_AG A: G rs_AC & gt; A: C rs_AG A: G Hétérozygotie Nom Position Observer Prévu HW P Génotype,% Allèle MAF Rating rs_CT & gt; C: T rs_GC & gt; C: G rs_insinsG_NIno_insertion_insinsG A: G rs_CG & gt; C: G rs_GT & gt; G: T rs_CG C: G rs_GA G: A rs_GA & gt; G: A rs_GA G: A rs_TA T: A Exclus de l’analyse rs_AG A: G rs_AC & gt; A: C rs_AG A: G NOTE MAF, fréquence des allèles mineurs Ce tableau n’apparaît que dans la version en ligne du journalViewThree des SNP-rs P =, modèle dominant, rs P =, modèle additif, et rs P = × -, modèle récessif – se sont révélés statistiquement significativement associés au phénotype LTNP après la correction de Bonferroni définie comme P & lt; Tableau Le SNP rs présentait une valeur P nominale positive récessive P = Pour compléter notre analyse, les génotypes HLA-A ont été ajoutés au modèle Malgré le fort déséquilibre de liaison de la région génomique, le SNP rs reste statistiquement significativement associé à la progression de la maladie. Tableau, alors que le HLA-A n’était pas associé à la progression après la correction de Bonferroni P =

Tableau Associations entre les polymorphismes mononucléotidiques ZNRD SNP et les patients LTNP à long terme sans progression, sans% Progression SNPP SNP brut Pa OU% CI Pa après ajustement pour le modèle dominant HLA-A res b c NI / NI référence NI / insG, insG / insG – modèle additif r b b GG référence GA – AA rs modèle récessif × -b b AA, référence AG GG – patients, non% SNP PNPP Progression Pa PA% IC% après ajustement pour HLA-A res modèle dominant b c NI / NI de référence NI / insG, insG / insG – rs modèle additif b c GG référence GA – AA rs modèle récessif × -b b AA, référence AG GG – NOTE Les fréquences, les valeurs P et les rapports de cotes sont affichés pour les SNP avec statistiquement significativement des associations avec le phénotype LTNP, avant et après ajustement pour la présence de HLA-A Toutes les données sont ajustées en fonction du sexe IC, intervalle de confiance; insG, G insertion; NI, pas de valeur d’insertion pour le SNP dans le modèle génétique le mieux adaptébStatistiquement significatif après la correction de Bonferroni P & lt; cStatistiquement significatif par P & lt; La structure de déséquilibre de liaison de la région génomique ZNRD a été déterminée, avec des blocs d’haplotypes déterminés. Figure B Le bloc plus grand contenait des SNP et des exons ZNRD inclus Le second bloc contenait des SNP et incluait le dernier exon du gène ZNRD Figure B Associations positives, avec analyse en utilisant tous les haplotypes de marqueur possibles contenus dans les blocs, on a trouvé et impliqué un haplotype dans chacun des blocs Figure B

Inhibition de la réplication du VIH due à la régulation à la baisse de l’expression de ZNRD mais pas à l’expression de RNF

L’effet de ZNRD et RNF sur l’infection par VIH a été évalué en utilisant l’interférence ARN. Les cellules HeLa-PR-MAGI ont été transitoirement transfectées avec des siRNA ciblant ZNRD siZNRD_ et siZNRD_ et RNF siRNF_ et siRNF_, et leur effet a été évalué par qPCR en temps réel; SiZNRD_ et RNF_ étaient les séquences ayant obtenu le meilleur silence Figure A Une analyse par transfert de Western des niveaux de protéines ZNRD a montré une corrélation avec les niveaux d’ARNm Figure B

Répression du VIH par le virus de l’immunodéficience humaine due à l’interférence par interférence ARN ZNRD dans les lignées cellulaires dérivées de HeLa A, inhibition induite par interférence ARN de l’expression du transcrit ZNRD et RNF Quantification de l’ARN messager de l’ARN messager relatif de ZNRD et RNF dans les cellules HeLa-PR-MAGI transfectées avec différents ARN interférents courts siRNAs ciblant ces transcrits cellulaires est montré Un siNN non ciblant siNT et un siRNA ciblant une séquence virale siRev / Env ont été utilisés comme contrôles Les valeurs ont été normalisées à celles des cellules transfectées simulées Moyennes ± écarts-types SD pour des expériences indépendantes sont représenté B, Western blot de ZNRD dans des cellules HeLa-PR-MAGI transfectées avec siRNA ciblant ZNRD transcript C, Inhibition de la réplication du VIH dans siRNA ciblant ZNRD, mais pas RNF, ARNm Le pourcentage de réplication du VIH-NL par rapport au témoin factice est Les moyens indiqués sont les écarts-types pour au moins des expériences indépendantes. D, Inhibition de la réplication des souches VIH et R du VIH par siZNRD-t Cellules traitées Le pourcentage de réplication virale pour différents virus comparé au contrôle fictif est représenté. Moyennes ± écart-type pour des expériences indépendantes sont représentées E, ZNRD ARNm stable régulation à la baisse par ARN courte ARN en épingle à cheveux dans des cellules TZM-bl Quantification ZNRD mRNA Cellules TZM-bl TZMwt, cellules contenant un shRNA TZMshCTRL non ciblé et cellules ZNRD silencieusement stabilisées TZMshZNRD sont montrées Les valeurs ont été normalisées par rapport à celles des cellules de type sauvage. Les moyennes ± SD pour des expériences indépendantes sont représentées. F, Inhibition de la réplication du VIH dans TZMshZNRD cellules Le pourcentage de réplication du VIH-NL par rapport à celui dans les cellules de type sauvage est indiqué. Les moyennes ± écart-types pour des expériences au moins indépendantes sont représentées par la ßgal, ß-galactosidase; ND, pas de médicament * P & lt; ; ** P & lt; ; *** P & lt; Figure Vue largeDownload slideInhibition de la réplication du VIH de type virus de l’immunodéficience humaine due à l’interférence par interférence ARN ZNRD dans les lignées cellulaires dérivées de HeLa A, inhibition induite par l’ARN de l’expression de transcription ZNRD et RNF ARN messager relatif quantification de ZNRD et RNF dans HeLa Cellules -PR-MAGI transfectées avec différents ARN interférents courts siRNAs ciblant ces transcrits cellulaires est montré Un siNN non ciblant siNT et un siRNA ciblant une séquence virale siRev / Env ont été utilisés comme témoins Les valeurs ont été normalisées à celles des cellules faussement transfectées Moyennes ± écarts-types Les SD pour des expériences indépendantes sont représentées B, Western blot de ZNRD dans des cellules HeLa-PR-MAGI transfectées avec siRNA ciblant ZNRD transcript C, Inhibition de la réplication du VIH dans siRNA ciblant ZNRD, mais pas RNF, ARNm Le pourcentage de réplication HIV-NL- comparé au contrôle fictif est montré Moyens ± SDs pour au moins des expériences indépendantes sont représentés D, Inhibition de re Les pourcentages de réplication virale pour différents virus comparés au contrôle fictif sont indiqués. Les moyennes ± écart-type pour des expériences indépendantes sont représentées. E, ZNRD ARNm stable régulation à la baisse par shRNA en épingle à cheveux courte en Cellules TZM-bl Quantification relative de l’ARNm de ZNRD dans des cellules TZM-bl de type sauvage TZMwt, cellules contenant un shRNA de contrôle non ciblé TZMshCTRL et des cellules ZNRD silencieusement stabilisées TZMshZNRD est montrée Les valeurs ont été normalisées par rapport à celles des cellules de type sauvage. sont représentés F, Inhibition de la réplication du VIH dans les cellules TZMshZNRD Le pourcentage de réplication du VIH-NL par rapport à celui dans les cellules de type sauvage est représenté. Les moyennes ± SD pour des expériences au moins indépendantes sont représentées ßgal, ß-galactosidase; ND, pas de médicament * P & lt; ; ** P & lt; ; *** P & lt; Des cellules HeLa-PR-MAGI transfectées par un ARNsi ont été infectées par la transfection de la souche X-tropic NL- avec une réplication du VIH inhibée par siZNRD_ Figure C, comparée à celle des cellules faussement transfectées ou siNT-transfectées, alors qu’aucun des siRNA ciblant le RNF n’était capable d’inhiber la réplication siZNRD_, qui n’a produit qu’une légère réduction des niveaux d’expression de ZNRD, n’a pas inhibé de manière statistiquement significative la réplication du VIH Figure CTLe rôle joué par ZNRD dans l’infection par le VIH a été confirmé par l’infection des cellules HeLa-PR-MAGI. -Structure adaptée au laboratoire -tropique BaL et l’isolat clinique UG Figure D ZNRD silencing altération de la réplication virale de BaL et UG dans une mesure similaire à celle de NL- écart moyen d’inhibition moyenne [SD],% ±% pour NL,% ±% pour BaL, et% ±% pour UG Figure DTZM-bl cellules exprimant de manière stable un shRNA ciblant ZNRD TZMshZNRD ou un shRNA contrôle non ciblant TZMshCTRL ont été générées La régulation à la baisse spécifique de l’expression du gène ZNRD a été confirmée à l’ARNm F igure E et protéines Niveaux de la figure Infection aiguë des cellules TZMshZNRD inhibée par la réplication du VIH- NL signifie une diminution ± SD,% ±%, comparée à celle des cellules TZM-bl de type sauvage ou TZMshCTRL moyenne ± SD,% ±% Figure F Non des changements ont été observés dans la viabilité cellulaire ou dans le récepteur de la CD et les données d’expression de la surface des cellules du corécepteur du VIH non montrées

Figure Vue largeDownload slideInhibition de l’expression de la protéine ZNRD dans les cellules TZM-blFigure View largeDownload slideInhibition de l’expression de la protéine ZNRD dans les cellules TZM-bl

Effet de ZNRD sur la réplication du VIH dans les cellules lymphoïdes

Une lignée cellulaire lymphoïde SupT régulant de manière stable l’expression de ZNRD SupTshZNRD ou hébergeant un shRNA ciblant le gène de la luciférase SupTshLUC a été générée. Figure A Des modifications de l’expression de CD, CXCR ou CD n’ont pas été détectées et aucun effet néfaste sur la cellule viabilité ou prolifération observée dans une courbe cinétique de croissance Figure B

Figure Vue largeDownload de la réplication du virus de l’immunodéficience humaine de type VIH dans les cellules lymphoïdes en raison de l’inhibition de ZNRD par l’ARN court A, ZNRD ARN messager de l’ARN messager A ARN régulé par shRNA dans les cellules SupT Quantification relative de l’ARNm ZNRD dans les cellules SupT de type sauvage SupTwt , les cellules abritant un shARN de contrôle ciblant la luciférase SupTshLUC, et les cellules ZNRD stabilisées de manière stable SupTshZNRD sont représentées Les valeurs ont été normalisées par rapport à celles des cellules de type sauvage. Des écarts ± écart-type SD pour des expériences indépendantes sont représentés ** P & lt; B, Cinétique de croissance des cellules SupT contenant des ARNsh La croissance cellulaire pendant les jours a été mesurée en nombre de cellules par millilitre. Moyens ± écart-type pour différentes mesures sont représentées C, Inhibition de la réplication du VIH dans les cellules SupTshZNRD -type cells est montré Moyens ± SDs pour au moins des expériences indépendantes sont représentées ND; pas de médicament ** P & lt; ; *** P & lt; D, évolution temporelle de la production de p dans les cellules SupT La production de p dans les surnageants cellulaires a été mesurée, et jours après l’infection L’inhibition de la réplication VIH- NL a été maintenue pendant l’infection Une expérience représentative est montrée CAp, antigène capsidique du VIHFigure Voir grandTélécharger glissement de la réplication du VIH de type immunodéficience humaine dans les cellules lymphoïdes en raison de l’inhibition de la ZNRD par l’ARN courte shRNA A, ZNRD ARN messager ARNm stable régulation négative par shRNA dans les cellules SupT quantification de ZNRD mRNA relative dans les cellules SupT de type sauvage SupTwt, cellules hébergeant un shRNA de contrôle ciblant la luciférase SupTshLUC, et des cellules ZNRD stabilisées de manière stable SupTshZNRD est montré Les valeurs ont été normalisées par rapport à celles des cellules de type sauvage. Moyens ± écart-types SD pour des expériences indépendantes sont représentées ** P & lt; B, Cinétique de croissance des cellules SupT contenant des ARNsh La croissance cellulaire pendant les jours a été mesurée en nombre de cellules par millilitre. Moyens ± écart-type pour différentes mesures sont représentées C, Inhibition de la réplication du VIH dans les cellules SupTshZNRD -type cells est montré Moyens ± SDs pour au moins des expériences indépendantes sont représentées ND; pas de médicament ** P & lt; ; *** P & lt; D, évolution temporelle de la production de p dans les cellules SupT La production de p dans les surnageants cellulaires a été mesurée, et jours après l’infection. L’inhibition de la réplication du VIH- NL a été maintenue au cours de l’infection. les cellules SupT exprimant shRNA exprimées avec NL- ont montré que la régulation négative de ZNRD inhibait l’inhibition moyenne de la réplication du VIH ± SD,% ±%, comparée à celle des cellules de type sauvage ou témoins signifient inhibition ± SD,% ±% Figure C et ré

Restauration de la réplication du VIH due à la complémentation de l’expression de ZNRD de type sauvage dans des cellules shZNRD

Des lignées de cellules SupT et TZM-bl régulant de manière stable l’expression de ZNRD ont été transfectées avec un plasmide d’expression ZNRD de type sauvage pZNRD ou, en variante, avec un plasmide d’expression de protéine fluorescente verte comme témoin. La récupération ou la surexpression de ZNRD de type sauvage a été mesurée par La surexpression de la protéine de type sauvage a complètement restauré les niveaux d’expression de l’ARNm de ZNRD dans les cellules SupT, où l’inhibition du shZNRD était plus modeste , mais ne les a restaurés que partiellement dans les cellules TZM-bl, dans lesquelles l’inhibition était plus puissante. Figure Infection aiguë avec niveaux de replication du VIH restaurés par NL dans les cellules TZMshZNRD et SupTshZNRD transfectées avec le plasmide d’expression ZNRD moyenne ± SD,% ±% pour TZMshZNRD et% ±% pour SupTshZNRD, comparés à ceux dans des cellules transfectées simulées signifient ± SD,% ±% pour TZMshZNRD et% ±% pour SupTshZNRD ou des cellules transfectées avec le contrôle l plasmide moyenne ± SD,% ±% pour TZMshZNRD et% ±% pour SupTshZNRD Figure

Vue de la figure largeDownload slideRestoration de l’expression de ZNRD dans les lignes de cellules TZM et SupTFigure View largeDownload slideRestoration de l’expression de ZNRD dans les lignées cellulaires TZM et SupT

Figure Vue largeDownload slideRécupération de la réplication du VIH de type virus de l’immunodéficience humaine en raison de la restauration de l’expression ZNRD dans les lignées cellulaires TZM-blshZNRD et SupTshZNRD Le pourcentage de réplication du VIH-NL dans les différentes cellules TZM-bl cellules A ou SupT B transfectées avec un vert Le plasmide témoin exprimant la protéine fluorescente pGFP ou un plasmide exprimant ZNRD pZNRD de type sauvage est représenté La réplication du VIH a été récupérée dans des cellules shZNRD lorsque l’expression de ZNRD a été restaurée. Les ± écart-types pour au moins des expériences indépendantes sont représentés; CAp, antigène capsidique du VIH * P & lt; ; ** P & lt; ; *** P & lt; Figure Vue largeDownload slideRécupération de la réplication du VIH de type virus de l’immunodéficience humaine en raison de la restauration de l’expression ZNRD dans les lignées cellulaires TZM-blshZNRD et SupTshZNRD Le pourcentage de réplication du VIH-NL dans les différentes cellules TZM-bl cellules A ou SupT B transfectées avec un vert Le plasmide témoin exprimant la protéine fluorescente pGFP ou un plasmide exprimant ZNRD pZNRD de type sauvage est représenté La réplication du VIH a été récupérée dans des cellules shZNRD lorsque l’expression de ZNRD a été restaurée. Les ± écart-types pour au moins des expériences indépendantes sont représentés; CAp, antigène capsidique du VIH * P & lt; ; ** P & lt; ; *** P & lt;

Effet de ZNRD sur la transcription virale à partir du promoteur LTR

Les cellules MOLT-CCR infectées avec la souche VIH ont été co-cultivées avec des cellules HeLa-PRMAGI transfectées avec siZNRD_ ou siNT siNT non ciblant contrôle siRNA Fusion a été surveillé par coloration intracellulaire β-galactosidase de cocultures pendant la nuit ZNRD déplétion n’a pas altéré la fusion médiée par l’enveloppe du VIH Figure

Figure Vue largeDownload slideAucune inhibition du virus de l’immunodéficience humaine La fusion du VIH due au silençage ZNRDFigure VasteDownload slideAucune inhibition du virus de l’immunodéficience humaine La fusion du VIH due au silençage ZNRDL’ADN proviral a été mesuré h après l’infection dans les cellules TZMshZNRD et SupTshZNRD avec leurs lignées cellulaires parentales et de contrôle respectives. Des différences ont été observées entre shZNRD et les cellules témoins Figure A, indiquant que la régulation négative de ZNRD n’affecte pas l’entrée virale ou la transcription inverse L’intégration virale à h a été quantifiée par PCR Alu-LTR suivie d’une PCR provirale pas modifier l’intégration de l’ADN proviral du VIH Figure A Des résultats similaires ont été obtenus avec des cellules HeLa-PR-MAGI transfectées avec des données siZNRD non montrées

Figure Vue largeDownload slideInhibition de la transcription du VIH du virus de l’immunodéficience humaine due à la régulation négative de l’expression ZNRD A, ADN proviral du VIH, mesuré par qPCR en chaîne polymérase quantitative, dans les cellules TZM-bl et SupT aux barres noires et blanches h infection, dans ce cas précédée d’un premier cycle de PCR répétée terminale Alu-long Le nombre de copies provirales VIH par cellule a été obtenu en utilisant une courbe standard et la quantification du gène cellulaire. Les valeurs RNAseP sont exprimées en pourcentages par rapport à Cellules de type Moyennes ± écart-types Les écarts-types pour les expériences indépendantes sont représentés AZT, zidovudine B, Rapports relatifs de différents ARN messagers transcrits de nef, gag et multipliés de VIH mesurés par qPCR en temps réel et normalisés en β-actine dans les cellules TZM-bl jours après l’infection. Les moyennes ± écarts-types pour les répliques d’une expérience représentative sont représentées * P & lt; ; ** P & lt; ; *** P & lt; Figure Vue largeDownload slideInhibition de la transcription du VIH du virus de l’immunodéficience humaine due à la régulation négative de l’expression ZNRD A, ADN proviral du VIH, mesuré par qPCR en chaîne polymérase quantitative, dans les cellules TZM-bl et SupT aux barres noires et blanches h infection, dans ce cas précédée d’un premier cycle de PCR répétée terminale Alu-long Le nombre de copies provirales VIH par cellule a été obtenu en utilisant une courbe standard et la quantification du gène cellulaire. Les valeurs de RNAseP sont exprimées en pourcentages par rapport à Cellules de type Moyennes ± écart-types Les écarts-types pour les expériences indépendantes sont représentés AZT, zidovudine B, Rapports relatifs de différents ARN messagers transcrits de nef, gag et multipliés de VIH mesurés par qPCR en temps réel et normalisés en β-actine dans les cellules TZM-bl jours après l’infection. Les moyennes ± écarts-types pour les répliques d’une expérience représentative sont représentées * P & lt; ; ** P & lt; ; *** P & lt; La transcription virale a été mesurée quelques jours après l’infection par qPCR en temps réel de différentes espèces d’ARNm virales gag, nef, et épissage multiple tat / rev / nef Dans tous les cas, le silençage ZNRD a conduit à une diminution statistiquement significative de la quantité d’ARNm viral comparé avec cela dans les cellules témoins ou sauvages Figure B Pris ensemble, ces résultats ont pointé vers la transcription virale comme l’étape inhibée par le silençage ZNRD

Discussion

d Réplication du VIH La régulation négative du ZNRD entrave la réplication du VIH dans les lignées cellulaires lymphoïdes sans altérer la viabilité ou la prolifération cellulaire, augmentant ainsi sa pertinence pour les cellules qui sont des cibles naturelles du VIH De plus, nous avons rétréci l’étape moléculaire à laquelle la ZNRD affecte la réplication virale. Fait important, nous avons trouvé que les polymorphismes génétiques situés dans le gène ZNRD étaient statistiquement significativement associés au phénotype LTNP indépendamment des effets HLA-A, fournissant ainsi une indication supplémentaire que le gène ZNRD est un nouveau cofacteur qui affecte le cours de l’infection à VIH in vitro et in vivoChaque étape du cycle de vie du VIH dépend de la machinerie cellulaire Pour ZNRD, nous avons réduit son mode d’action à la transcription virale du promoteur LTR, en éliminant tout effet sur les événements précoces de réplication virale. et al ont suggéré que ZNRD pourrait agir avant la traduction de Gag Des travaux supplémentaires seront nécessaires pour clea Comprendre le mode d’action du ZNRD dans l’infection par le VIH Un élément important à élucider serait l’effet partiel apparent de l’interférence ARN transitoire et stable du ZNRD. En outre, la puissance du knockdown dépendant de l’ARN semble corréler avec la puissance d’inhibition du VIH. réplication du virus, mais knockout total n’a pas pu être atteint Ces résultats, ainsi que l’observation que la complémentation de l’expression ZNRD dans les cellules de type sauvage n’a pas augmenté la réplication virale, suggèrent qu’un faible niveau d’expression de ZNRD peut être suffisant pour permettre la réplication et que La susceptibilité humaine à l’infection virale peut être considérée comme le résultat final d’une interaction dynamique entre la constitution génétique de l’hôte individuel et du pathogène, les influences environnementales ajoutant une autre couche de complexité. une image complexe, cependant, plusieurs polymorphismes génétiques ont été décrits La complexité génétique et le déséquilibre élevé des liens de la région remettent en question l’effet de la ZNRD sur la progression de la maladie VIH Contrairement aux résultats de ces études. , nos données indiquent un rôle pour le gène ZNRD dans la progression de la maladie VIH indépendamment de l’allèle HLA-A, un facteur proposé pour être responsable d’une grande partie de l’effet des polymorphismes ZNRD dans le gène ZNRD reste statistiquement significativement associé au LTNP phénotype lorsque HLA-A a été introduit comme covariable dans l’analyse En outre, l’effet de HLA-A n’a pas été significativement associé à la progression, suggérant un effet plus discret s’il y en a et un rôle indépendant pour ZNRD, conformément aux résultats de autres études d’association [,,,] Bien que les études antérieures aient été basées sur la structure spatiale complexe et le modèle de déséquilibre de liaison d’une région relativement grande, nous nous sommes davantage concentrés sur Les observations des déterminants du contrôle de l’infection par l’hôte basées sur les SNP doivent être répliquées dans des populations pertinentes, suivies par des analyses génomiques et fonctionnelles plus approfondies de l’ADN associé. région pour vérifier les variantes causales putatives Identification des polymorphismes dans les gènes pertinents pourrait être la clé pour éclaircir la base de la pathogenèse de la maladie VIH Nous n’avons pas identifié de mutations ponctuelles ou de polymorphismes avec des implications fonctionnelles claires, soit au niveau de l’ARNm ou de la protéine On a prédit que le SNP rs crée un nouveau site d’épissage qui conduit à une isoforme différente de l’ARNm sans altérer la séquence codante du gène. De plus, le SNP avec la valeur P la plus faible est situé dans la région non traduite du gène ZNRD. impliqués dans la régulation post-transcriptionnelle de l’ARNm par, par exemple, les micro-ARN Ainsi, la possibilité que t Les polymorphismes ou les haplotypes qui affectent des caractéristiques telles que la biogenèse, le transport ou la stabilité de l’ARNm peuvent avoir un effet sur le ZNRD et conduire à des niveaux d’expression altérés, avec des effets sur la réplication du VIH ressemblant à la réplication du VIH. les résultats obtenus in vitro Les travaux futurs mettront en lumière les mécanismes de régulation putatifs si ceux qui sous-tendent la SNPsA stratégie thérapeutique clé pour traiter les patients séropositifs a été de cibler simultanément plusieurs protéines codées par le virus pour surmonter l’émergence de la résistance. La caractérisation des cofacteurs cellulaires représente une alternative prometteuse En effet, l’utilisation de gènes cellulaires comme cibles pour des médicaments antiviraux devient déjà réalité, comme le montre le corécepteur CCR et son antagoniste, le maraviroc Cibler plusieurs produits de gènes de cellules hôtes minimiserait l’acquisition de la résistance aux médicaments et de fournir un blocage de longue durée de virus réplicats sur

Remerciements

Nous reconnaissons les patients de cette étude. Nous reconnaissons également la BioBank du VIH Instituto Carlos III ISCIII intégrée dans le projet espagnol de recherche sur le SIDA RD // et les centres collaborateurs pour les dons d’échantillons cliniques. Nous remercions les Instituts Nationaux de Santé des Etats-Unis. Programme et programme de l’Union européenne Vaccin européen contre le SIDA Facilité centralisée EVA pour les réactifs contre le SIDA Institut national pour les normes biologiques et le contrôle, Royaume-Uni pour les réactifs Soutien financier Ce travail a été soutenu par le ministère espagnol de la Ciencia e Innovación projets BFU-, BFU- et SAF –C AT et AC sont soutenus par le Fonds national suisse de la recherche. Conflits d’intérêts potentiels Tous les auteurs: pas de conflits